                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:10 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atacccgtaggtatccccaccacggcccgccatagaaaaggacgcaccaacggtgtgtgacggacgtaaaaatagccgcaataggcggctgtccgcctta
ctgttcaggtcgccaaacccggtcgcgctattgaacacgacgcggtaatggtgcggcaatcggatggggctgtcaagcatgtgattcacatattgcgttt
gagcggtgcatttcatcgggatataatggcgctggatggtttgatttagttttgctgtacccaaggccctggcaggggcctttttatttttggagcggtg
ATG

    CV0644 Gene: CV0644     GI: 34496099     BI number: CV0644     GOG: -------     Description: hypothetical protei             t           t  a            tg            at   a        gt a  t      t  t t  g      t  t a  g       tg t  c       gc a  g       gt gc        tg gt        at g  g      |  a       gc cg       |  c      g  a ta        gc        tg at        gc        cg cg        ta        cg tg       c  a       cg t  t      g  g       gc t  t       cg        gc at        gc        at cg        gc        at                         tttatttttggagcggtgATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_violaceum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=14 nt.     Delta G= -7.30 kcal/mol Antiterminator: Size=41 nt.     Delta G= -8.30 kcal/mol Anti-antiterminator:   Size=35 nt.     Delta G= -6.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case atacccgtaggtatccccaccacggcccgccatagaaaaggacgcaccaacggtgtgtgacggacgtaaaaatagccgcaataggcggctgtccgcctta ctgttcaggtcgccaaacccggtcgcgctattgaacacgacgcggtaatggtgcggcaatcggatggggctgtcaagcatgtgattcacatattgcgttt gagcggtgcatttcatcgggatataatggcgctggatggtttgatttagttttgctgtacccaaggccctggcaggggcctttttatttttggagcggtg ATG     CV0644 Gene: CV0644     GI: 34496099     BI number: CV0644     GOG: -------     Description: hypothetical protei             a           g  t            tt            tt   a        ta a  t      g  g t  g      g  t a  g       tt t  c       at a  g       gt gc        gg gt        tc g  g      |  t cg       |  g ta        ct at        ga        gc cg        cc       g  a tg       g  c       tg t  t      g  c       cg t  t       ta        cg at        aa        cg cg        ag        gc                         ctttttatttttggagcggtgATG     ..................................................................................................................