                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-21.90 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-11.60 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtttttttcaacacaccgaaacagctgctttgggttacgtcctaccacggcatgcattgccaatactcacttacccccagcgcgcgctatcgaagcccc
gcctcgcccccgcgcttcatgtgccgctaatcatgcacctgcatgaacctgcgccaggcccttgccgtatggcctggcgcgctgtttttcccctgccctg
attcatgcgttttcatgcagtctatgcatgcagtcgccgttttggctgactgacgtttccgcccttctctctcctctcccgcttaaattggccgccgagt
ATG

    CV0649 --- CV0648 --- CV0647 --- CV0646 --- CV0645 Gene: CV0649     GI: 34496104     BI number: CV0649     GOG: -------     Description: hypothetical protein Gene: CV0648     GI: 34496103     BI number: CV0648     GOG: COG3311     Description: probable prophage regulatory protein Gene: CV0647     GI: 34496102     BI number: CV0647     GOG: -------     Description: hypothetical protein Gene: CV0646     GI: 34496101     BI number: CV0646     GOG: NOG04097     Description: probable major capsid protein of prophage P2 Gene: CV0645     GI: 34496100     BI number: CV0645     GOG: NOG42748     Description: conserved hypothetical protei   c g  c c  c t  c c  c cg gc c  | c  | c  |       cc cg       a  t gc        cg        cc at        gc       g  g at        ta       t  t gc        at       t  a c  |       cg       c  t ta        ta        cg at       |  a       cg t  |      a  c       gc cg       a  c       gc gt       t  t       at cg        cg        cg gc        gc        cg c  |       cg        gc gc       c  c       cg cg        gc        gc gc        ta        tg                         ctgtttttcccctgccctgattcatgcgttttcatgcagtctatgcatgcagtcgccgttttggctgactgacgtttccgcccttctctctcctctcccgcttaaattggccgccgagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG3311 Predicted transcriptional regulator ... can be seen here     ..................................................................................................................