                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTGACTTTCAGCGGAACAGTCAGCGAAGAAGTGGGCGCGCCGGCCGTGCCGTTCACC
GAAACCTGGCATTACGTCAAGGACGGCGGCACCGGCGGCAAATGGCTGGTGGCCGGCA
TCCAGCAGAATTGAcgacgccgcgggcggctgttgtttttgccgcgcgcttaacaatcgttgacgacgggccctcgggcccgttttttat
ttgaacgcccatgcactaaactggaatgccgattgcttcagcagcggacaagggccgacagagcccgcatcttggacacggaggcagtatcgcgATG

    CV0657 Gene: CV0657     GI: 34496112     BI number: CV0657     GOG: COG2200     Description: conserved hypothetical protei            at           a  c            cg gt        at t  t       at t  t       tg g  t       ta t  t      c  | cg        gc        tc gc        cg       c  g gc       |  a       cg cg        gc        cg gc        cg        gc g  g      g  |       gc gc        cg        gc cg        cg        cg gc        gc        at                         tttttatttgaacgcccatgcactaaactggaatgccgattgcttcagcagcggacaagggccgacagagcccgcatcttggacacggaggcagtatcgcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2200 FOG: EAL domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_violaceum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -9.50 kcal/mol Antiterminator: Size=47 nt.     Delta G=-16.20 kcal/mol Anti-antiterminator:   Size=29 nt.     Delta G=-15.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGTGACTTTCAGCGGAACAGTCAGCGAAGAAGTGGGCGCGCCGGCCGTGCCGTTCACC GAAACCTGGCATTACGTCAAGGACGGCGGCACCGGCGGCAAATGGCTGGTGGCCGGCA TCCAGCAGAATTGAcgacgccgcgggcggctgttgtttttgccgcgcgcttaacaatcgttgacgacgggccctcgggcccgttttttat ttgaacgcccatgcactaaactggaatgccgattgcttcagcagcggacaagggccgacagagcccgcatcttggacacggaggcagtatcgcgATG     CV0657 Gene: CV0657     GI: 34496112     BI number: CV0657     GOG: COG2200     Description: conserved hypothetical protei             C           C  G           G  G            GC            TA           |  T            GC            GC         c            TA       g  g            CG        cg            GC        cg           |  A       gc           |  G       cg AA       G  A      a  g C  A       TA       g  | G  T       AT       c  | G  G       AT       A  | CG       |  G      G  | GC       |  A      T  | GT       |  c      T  | CG       |  g      A  | CG       |  a      A  | AT       A  c       Gc |  G       Cg        At CG        Gc        Cg GC        Gc        Gt GC        Cg        At CG        Gc        Cg                         tttttgccgcgcgcttaacaatcgttgacgacgggccctcgggcccgttttttatttgaacgcccatgcactaaactggaatgccgattgcttcagcagcggacaagggccgacagagcccgcatcttggacacggaggcagtatcgcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2200 FOG: EAL domain ... can be seen here     ..................................................................................................................