Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -6.31 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAGTTCTCCGCCTTGGTCAGCTTCAGCTACAACCTGGGGCTGGGAAACCTCCGCAGC
TCCACGCTGCTGCGCCTGTTGAACAAGGGCGATTACGACGGCGCCGCCGCGCAGTTCC
CGCGCTGGAACCGGGCCGGCGGCCAGGCCGTGCCCGGACTGACTCGCCGCCGCAAAGC
CGAGCAGGCGCTGTTCCTGACGCCTGCCCCCTGCTGAgcttcacaagccgcctctccctccgtcctgacaaca
gtccgccggctccgccgcgggctgttttcgcactcaacctccggagatacgccATG

    CV0726 --- CV0725


Gene: CV0726     GI: 34496181     BI number: CV0726     GOG: -------     Description: hypothetical protein
Gene: CV0725     GI: 34496180     BI number: CV0725     GOG: -------     Description: hypothetical protei


  a
c  c
 ta
 ta
 cg
 gc
A  c
G  |
T  |       ca
 Cg       a  a
 Gc        gc
T  c       ta
C  t       cg
C  c      c  t
C  t      t  c
C  c       gc
C  c       cg
G  c      c  c
T  t      t  |
C  c      c  |
C  |      c  |        c
 Gc       c  |      t  c
 Cg       t  |       cg
 At       c  |       gc
 Gc       t  |       gc
T  c      c  |      c  |
C  t      c  |       cg
C  |       gc        gc
 Tg        cg        cg
 Ta        cg        cg
 Gc        gc        tg
 Ta        at        gc
                        tgttttcgcactcaacctccggagatacgccATG


    ..................................................................................................................