                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.23 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGGGAACACGCCTTCCGGGTCCGCGCCGGACAGGGTGAAGGCGTCGGTGTGGCAGA
CGCCGGTGGCCACCATCTTCACGCGCACCTCGCCGGCCTTGGGCGGATGCACCTCGAT
CTCTTCGATGCTCAACGGTTGGCCGGCGGCCCAGGCTACGGCAGCCTGGCAGCGGATG
ATGTCATGGCTCATcggcgactccttgttcgcattgacggttctctagggtaatcaaccattgtatttttttgccggttatcgataatcg
gctgaattggtaaatgattttttctgtggagaaaaaATG

    CV0741 --- CV0742 Gene: CV0741     GI: 34496196     BI number: CV0741     GOG: COG0583     Description: probable transcriptional regulator, LysR family Gene: CV0742     GI: 34496197     BI number: CV0742     GOG: NOG42942     Description: conserved hypothetical protei   c c  t t  t cg at |  t gc cg gc         t |  a      t  g |  t      a  t |  t      c  a |  g      c  t |  a      a  t gc       a  t        a cg       c  t      t  a Tg       t  t      a  t At        at        gc C  t       at        cg T  c       tg        tg C  t       gc       |  c Gc        gc       |  t Gt       g  |      a  g Ta       a  |       ta |  g       tg        ta A  g       cg        gt C  g      t  t       gt T  t      c  t       cg G  a      t  |       cg Ta        ta        gt At        gt        ta Gc        gc        ta Ta        cg        ta                         tgattttttctgtggagaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................