                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGCGCTGTCGCGCGTCGAGGTCAGCGTCGCCTATCCGATGCTGTCCATCGGCTACG
TGGTCAACGCGCTGCTCGCCTACTGGATGTTCGGCGAGGCGCTGGCCACGCAGAAACT
GATAGGCATCGCCGTCATCATCGTCGGCGTGGTGCTGGTCGCTCGCAGCTGAaaaacgatt
cattagccacggaagcacacggaatgacacggaaagattcacggccccacacagccacgatttggccacacggccttccgtgtttttccgtttgcgtccg
tggctaattctcagggtttgaatATG

    CV0750 --- CV0749 --- CV0748 Gene: CV0750     GI: 34496205     BI number: CV0750     GOG: COG0399     Description: probable glutamine-scyllo-inositol transaminase Gene: CV0749     GI: 34496204     BI number: CV0749     GOG: COG0463     Description: probable dolichyl-phosphate b-D-mannosyltransferase Gene: CV0748     GI: 34496203     BI number: CV0748     GOG: COG0223     Description: probable transformylas tg a  a a  c       ac g  a      c  a gc       c  c cg       c  a |  g       cg a  a       gc        ca c  a       gc       a  c a  a      c  a       cg c  g      a  c       cg g  a      c  |       gc at        tg        gc at        ta       t  t gc        at       t  t g  a       gt       t  c c  c       at       a  | a  |      a  g       gc cg       a  g       cg cg        gc        at gc        gc        cg                         tttttccgtttgcgtccgtggctaattctcagggtttgaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0399 Predicted pyridoxal phosphate-dependent enzyme apparently involved in regulation of cell wall biogenesis ... can be seen here [M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here [J] COG0223 Methionyl-tRNA formyltransferase ... can be seen here     ..................................................................................................................