                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:63 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-23.10 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAGCGCGGCCCCGGCGCAAGCCGCCGAGAAGACCACGGTGGTCAAGTCGGTGGCGCA
AGCCGTTCATCACGGCGCCCAGGAGAGCCGGCAACAGCAGCAGCAACAGCAGCAACAG
CAGGCGCTGATTGGCGAAGATGGCGGCGTGCTGCTGCAATCCGTCAGCAGCGGCGGCT
TTGACGCCTAAggctgagaaacagcagggagtgggccgccatcacgtggcccatttgttttcttagagcctgtccacgatctttttccggcc
aaggccgcgcggcctgggtgccggaagaaaaatcGTG

    CV0754 --- CV0755 Gene: CV0754     GI: 34496209     BI number: CV0754     GOG: -------     Description: hypothetical protein Gene: CV0755     GI: 34496210     BI number: CV0755     GOG: -------     Description: hypothetical protei             a           g  a           a  a            gc            ta            cg            gc           g  a           A  |   T       A  | T  T       Tg C  G       Cg G  A       Cg        tc GC       G  a      a  a CG        Cg       c  c GC        At        cg GC       G  |       gt |  T      T  |       cg C  A       Tg        cg G  A       Tg        gc A  g       Cg        gc Cg        Gc        gc Gc        Gc        ta At        Cg        gt Cg        Gc        at Ta        Gc        gt                         gttttcttagagcctgtccacgatctttttccggccaaggccgcgcggcctgggtgccggaagaaaaatcGTG     ..................................................................................................................