Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-10.36 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATATCCAGTACCTGGGATGCGGCGCGCTTCGACGCTCTGCTGGGCGAGTATTGCGAT
AAACAGCGGGATGCGGCTTCGGGCGTCGGGGAGAGCGGGTGAagtgcgtcccgcgatggcgcgcgctga
tgctcatgtcgcttttatcctgcgccccgctcctcgctgtacgcgggcgtggggcggggctgaacggcgtgggcggagcggaaagcacggtccgcagcaa
tgtgctgttcgccaaattcaacctgggctttgatcgcctgggtgttttttaaccatgagactaggagaaatcgATG

    CV0756


Gene: CV0756     GI: 34496211     BI number: CV0756     GOG: -------     Description: hypothetical protei


            t
          a  g
          a  t
           cg
           gc
           at
           cg
           gt
          c  t
          c  c
           tg
           gc
  a        gc
a  g      |  a
a  c      |  a
g  a      |  a
 gc       |  t
 cg       |  t
g  g      |  c        g
 at       |  a      t  a
 gc       |  a      t  t
 gc       |  c      t  c
 cg       |  c       cg
 gc       |  t       gc
g  a      c  g       gc
g  |      a  g      g  t
t  |       cg       t  g
g  |       gc        cg
 cg        at        cg
 gc        at        at
                        gttttttaaccatgagactaggagaaatcgATG


    ..................................................................................................................