Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:171 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-23.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCTTGAAGTTCTTCAACAGCGCGCCCCAGCCCCAGTTGGTCGAACAGGCCTGCGGC
TGGACCGCCTTCGCGGCCGCCTGAcggcctcctcgccctcaaatcaaaacagcccgcaacgacgggctgttttgccatccgg
gcatggtcggatcaatgcctcatccaaaataattgatgtaagaaccattttacacatcgttacacaaaaccttcacgccgcccaaacaacacgtacatac
aagtaggccgacttttttcagaatagcgcctgatccatcaacccatgcagtcatgaagtcATG

    CV0758


Gene: CV0758     GI: 34496213     BI number: CV0758     GOG: -------     Description: hypothetical protei


           cc
          t  t
 CC       c  c
A  G       cg
 GC        gc
 GC        gc
T  T      c  c
C  |       At
 GT        Gc
 GC        Ta
 CG       |  a
 GC       |  a
 TG       |  t
 CG       |  c
|  C      |  a
|  C      |  a
 CG       |  a
 GC       |  a
 GC       |  c
 AT       C  a
 CG        Cg        ac
A  A       Gc       a  g
A  |      C  |      c  a
 Gc       C  |       gc
 Cg        Gc        cg
 Tg        Gc        cg
 Gc        Cg        cg
 Gc        Gc        gc
                        tgttttgccatccgggcatggtcggatcaatgcctcatccaaaataattgatgtaagaaccattttacacatcgttacacaaaaccttcacgccgcccaaacaacacgtacatacaagtaggccgacttttttcagaatagcgcctgatccatcaacccatgcagtcatgaagtcATG


    ..................................................................................................................