Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGCCGAGCTGGAGCAGGTCAAGCGCCGGCTGCCGGAAATCATGGCCGGCGCGGCCGA
GCTCAAAGTGCCGCTGCTGGCCGAGGTCGGGGCCGGCGACAGCTGGGAAGCCGCGCAC
TGAcgcgcccatcgcatccgtccggaacggcgccattcggcgccgttttgtttttgcgtcagcgcggacctgcactttcggatatgggcgccgcgcgg
cggctccggctttggtacagggtgcgcctggcgccggcgtcggcgctttcagactggcgactccccatatccgaatggagcatgcgATG

    CV0780


Gene: CV0780     GI: 34496235     BI number: CV0780     GOG: COG4970     Description: hypothetical protei


            a
          c  t
          c  c
           cg
           gc
          |  a
          |  t
          c  c
           gc
           cg
           At
          |  c
           Gc
           Tg
 CT        Cg
A  G      |  a       tt
C  A      |  a      a  c
 Gc       |  c       cg
 Cg       A  g       cg
 Gc        Cg        gc
 Cg        Gc        cg
C  |       Cg        gc
G  |       Gc        gc
A  |      C  c       cg
A  |      C  a       at
 Gc       G  |       at
 Gc        At        gt
 Gc        At        gt
 Ta        Gc        cg
                        tttttgcgtcagcgcggacctgcactttcggatatgggcgccgcgcggcggctccggctttggtacagggtgcgcctggcgccggcgtcggcgctttcagactggcgactccccatatccgaatggagcatgcgATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[NU] COG4970 Tfp pilus assembly protein FimT ... can be seen here

    ..................................................................................................................