                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-13.77 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAAGACCGGGACCAAGGCCAACCTGCCGGTGTCGGTGTGCGGCGAGATGGCAGGCGA
CGCGCGGCTGACCCGGCTGCTGCTGGGCATGGGCCTGCGCAAGTTCTCCATGCACCCG
GCCAACCTGCTGTCGGTCAAGCAGCGGGTGCTGACCAGCCATCTCGACGAGATCGCGC
CCATCGCGACGCGCATGCTCAGATCGGAAGACCCTGATAAAATAGCCGATCTGTTGCA
AATGCTGAATGCAGAGCCGGGCACCTAAcccggctttttagtttccggatttcgagaggtctccccgcATG

    CV0817 --- CV0818 Gene: CV0817     GI: 34496272     BI number: CV0817     GOG: COG0438     Description: probable glycosyltransferase Gene: CV0818     GI: 34496273     BI number: CV0818     GOG: COG0463     Description: probable glycosyltransferas GA T  T C  A C  A       AA C  A      A  T A  A       CG G  T       GC A  A      |  T A  G      |  G GC       |  A GC       |  A CG       T  T TA        TG         C AT        GC       C  T GC        TA       A  A AT        CG       C  A CG        TA        Gc |  T      |  G       Gc T  T      A  C       Gc CG        GC        Cg GC        CG        Cg TA        CG        Gc                         tttttagtttccggatttcgagaggtctccccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0438 Glycosyltransferase ... can be seen here [M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here     ..................................................................................................................