                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-19.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=14 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGGCCAGGACATCGGCGTCGCGCCCGGTTTCGCCACGCTATCGCTGGACGCGGGCT
GGAAGATCAGCAAGCGCTTCAAGCTGCTGGCCGGCGTCGACAATGTGTTCAACCGCGC
GTACGCGGAAAGCGTCAGCAAGGGCGGCGCCATGGTGGCCGGCTACACCCGGACCACC
CGCGTCAACGAGCCCGGCCGCACGCTGTGGACCAAGCTGCAGCTCGAGCTGTAAatatcc
gtccgtcctctcgtctcggggcttccagtctgctaggctggaagcctttttcacgatggcggcggcATG

    CV0894 --- CV0893 Gene: CV0894     GI: 34496349     BI number: CV0894     GOG: -------     Description: hypothetical protein Gene: CV0893     GI: 34496348     BI number: CV0893     GOG: COG3232     Description: probable 5-carboxymethyl-2-hydroxymuconate D-isomeras            ct           c  c           t  t            gc            cg           |  t           c  c           t  t            gc            cg            cg            tg         c           a  g      g  t           t  c      t  a           a  t       cg           A  t       tg           A  c       gc           T  |       at CG        Gc        cg T  A       Ta        cg CG        Cg        ta GC       G  t       ta AT       A  c       cg CG        Gt        gc GT        Cg        gc                         tttttcacgatggcggcggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3232 5-carboxymethyl-2-hydroxymuconate isomerase ... can be seen here     ..................................................................................................................