                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.50 kcal/mol
Antiterminator:    Distance from promoter:61 nt. Size=44 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:    Distance from promoter:48 nt.    Size=30 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggatt-tagaat. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggattttcgtagagcaattacgttagaatgcccgctgcactgagaaccgcaaggttttgaggtgttagcccctcgaaatatcgcgctggccgaggccgg
tccgatgtttcttcctcgtgttgacccctgccgcgatgccgcaggggtgtttttttgcctgtttcgatgcgttattcacatcgactgtcatcatcgttgc
acctatcatattgtgaaaatggcatgagcttgatcaagcgcctTTG

    CV0899 Gene: CV0899     GI: 34496354     BI number: CV0899     GOG: COG0840     Description: probable methyl-accepting chemotaxis protei            tc           t  t           t  t           g  c           t  c            at            gc            cg           |  t           |  g ga       |  t c  g      |  t cg        cg         a gc        ta       g  t gc        gc        cg tg        gc        gc cg       |  c      c  c gt       |  c       cg c  c      c  t       gc gc        cg        ta cg        gc        cg ta        gc        cg at       a  g       cg tg        gc        cg at        cg        at                         gtttttttgcctgtttcgatgcgttattcacatcgactgtcatcatcgttgcacctatcatattgtgaaaatggcatgagcttgatcaagcgcctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_violaceum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:49 nt.    Distance to gene:132 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.30 kcal/mol Antiterminator:    Distance from promoter:18 nt. Size=38 nt.     Delta G=-13.30 kcal/mol Anti-antiterminator:    Distance from promoter:7 nt.    Size=29 nt.     Delta G=-14.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tggatt-tagaat. It has a score value of 70.28 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tggattttcgtagagcaattacgttagaatgcccgctgcactgagaaccgcaaggttttgaggtgttagcccctcgaaatatcgcgctggccgaggccgg tccgatgtttcttcctcgtgttgacccctgccgcgatgccgcaggggtgtttttttgcctgtttcgatgcgttattcacatcgactgtcatcatcgttgc acctatcatattgtgaaaatggcatgagcttgatcaagcgcctTTG     CV0899 Gene: CV0899     GI: 34496354     BI number: CV0899     GOG: COG0840     Description: probable methyl-accepting chemotaxis protei            ta           t  g           g  c           t  c ca        gc g  a       gc        ga cg        at       c  g cg        gc        cg at        tg        gc at        ta        gc gt        ta        tg at        ta        cg |  g       gt        gt g  a      g  a      c  c tg       a  t       gc cg       a  c       cg at        cg        ta cg        gc        at gt        cg        tg                         tttcttcctcgtgttgacccctgccgcgatgccgcaggggtgtttttttgcctgtttcgatgcgttattcacatcgactgtcatcatcgttgcacctatcatattgtgaaaatggcatgagcttgatcaagcgcctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................