                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-17.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATGCTGGAGGTGGTGGCCAAGATGAGCGAGATCTCCAACTCCACCCAGGAGCAGCA
CAAGGCCACCACGCTGATCGCGCAGAGCTCGGAAGCGATCAACGGCCACGTGCTGGAA
AACGACGACGTGCTGCAGAACGTCAGCAGCACGCTGCAGGGACTGGCCGGCAGCGCCG
GCAAGATGGACGCCGAGTTCAACAAATTCCGGCTGTAAtgcccatccgccgcgccgaacgccgccttgccag
gcggcgtttttgcgtcgatgatccgaggcaaccgttccgattggcccacgcccgATG

    CV0900 Gene: CV0900     GI: 34496355     BI number: CV0900     GOG: COG0457     Description: hypothetical protei   A A  C C  A TA TA GT AT |  C GC CG CG GC |  T CG AT |  A |  A |  t |  g |  c Gc Gc                  gc Ta         g       t  c At       c  a       ta Gc       c  a       cg A  c       gc        cg A  |       cg        gc Cg        gc        cg Gc       c  c       cg Gc        cg        gc Cg        gc        cg                         tttttgcgtcgatgatccgaggcaaccgttccgattggcccacgcccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here     ..................................................................................................................