Gene putatively regulated by attenuation in C_violaceum
Characteristics of the secondary structures
Terminator: Distance to gene:201 nt. Distance to run of Ts=0 nt. Size=26 nt. Delta G=-21.60 kcal/mol
Antiterminator: Size=48 nt. Delta G=-21.13 kcal/mol
Anti-antiterminator: Size=42 nt. Delta G=-11.50 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
GGACTGGCTGGGCGAAGGCAAGGTCAAGGTGCTGTGGTGAcgccgcggcgctgaaccgccctcccgccgc
gccgccgttcgcctgaacggcggcgtttttcatgccggcgcgccgccttgccagccgcctcgccgtgcccctattatgccaacgggctccccgccgccgc
ggtcggcgccagccggaaacccaggccaggcgggcattggcgtgccgctgtcgcctgactgtcgccccgctgtccttgtccatcccgacgggccgaacca
cactgcagccagtgatcgaacggaggttttATG
CV0910
Gene: CV0910 GI: 34496365 BI number: CV0910 GOG: NOG09434 Description: hypothetical protei
c
c c
TG g t
A G c c
t G c c
t T a c
tG a g
tA g c
gc t c
g g cg
a | gc
gc cg
gc gc cc
cg gc g t
a | cg cg
a | gc ta
gc c c ta
cg cg gc
tg gt cg
a | c | cg
gc At gc
tg Gc cg
gc Tg cg
at Gc gc
cg Gc cg
tttttcatgccggcgcgccgccttgccagccgcctcgccgtgcccctattatgccaacgggctccccgccgccgcggtcggcgccagccggaaacccaggccaggcgggcattggcgtgccgctgtcgcctgactgtcgccccgctgtccttgtccatcccgacgggccgaaccacactgcagccagtgatcgaacggaggttttATG
..................................................................................................................