                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-12.71 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATCAATCAGCTGAACGCCGCCTTCGTCGACGAGCGCCTGGCGCAGGTGGAGAGCTC
GCTGGACGTGCTGCGCACGGCAGCGGCTTCCACGCTGGGTTATGGCCCCGACGGGCAG
CCGCCGGAGCTGGTGTCCGGCCGCCGTCTACTGGGTTCCGCCTGAtaggctcggcattgttttgcac
gggggcgctgcggcgccccttgtcgttttctgcgccggagcgacatcgcggtgggcgcgacccccgcctttatggtatcttccccagcggtcccgtgaaa
atcgctaaccagaatccATG

    CV1002 Gene: CV1002     GI: 34496457     BI number: CV1002     GOG: COG1270     Description: probable cobalamin biosynthesis transmembrane protei            gt           t  t           t  t            at            cg            gc           |  a            gc   C        cg T  C       tg T  G       cg GC       g  | GC       g  |       gc GT       a  |      t  g T  G      t  |       cg C  A      A  |       gc At       G  |       cg Ta       T  |       gc Cg        Cg        gc Tg        Cg        gc Gc        Gc        gc |  t       Cg        gt |  c      C  c      c  | Cg       T  t       at Cg        Tg        cg Gc        Gc        gt                         cgttttctgcgccggagcgacatcgcggtgggcgcgacccccgcctttatggtatcttccccagcggtcccgtgaaaatcgctaaccagaatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1270 Cobalamin biosynthesis protein CobD/CbiB ... can be seen here     ..................................................................................................................