Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:132 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-18.20 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-15.60 kcal/mol
Anti-antiterminator:   Size=12 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGCTACGAACCAGAGGGTCGGGCGTTCGAATCGCTCCGGGTGCGCCAgctGTCCCTA
TAGTTTAGCGGTTAGAACACCGCCCTTTCACGGCGGTAGCCGGGGTTCGATTCCCCGT
GGGGACGCCAggatgcagaaaaaagcctcgcatgaaaatgcggggcttttttcattccccagcatcgcctgccaagttccgccatatcccgct
gcgtcatttgcattgccatttttcttcgcaccgcaaaaatgacaaagagatatcctgttcttcccaacatccagacgagaacaggctcccGTG

    CV1019


Gene: CV1019     GI: 34496474     BI number: CV1019     GOG: COG1629     Description: probable TonB-dependent recepto


           GG
          G  A
           GC
           TG
           GC
          C  C
          C  A
           Cg
           Cg
           Ta
          |  t
          T  g
          A  c
          G  a
           Cg
           Ta        aa
          |  a      g  a
          |  a       ta
          |  a       at
          |  a       cg
          |  a       gc
 GT        Tg        cg
C  G       Gc        tg
 CG        Gc        cg
 CG        Gt        cg
 CG        Gc        gc
 TA        Cg        at
                        tttttcattccccagcatcgcctgccaagttccgccatatcccgctgcgtcatttgcattgccatttttcttcgcaccgcaaaaatgacaaagagatatcctgttcttcccaacatccagacgagaacaggctcccGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG1629 Outer membrane receptor proteins, mostly Fe transport ... can be seen here

    ..................................................................................................................