                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGAGACGATGGAGCAATGGCAGTTCCTGGAGCAGGAGGGCTGCGATTTCGTCCAAG
GCTATCTGATTGCCAAGCCGCTGCCGGCCGACGATTTCGCCGAACTGCTGCACAAGGA
CAGCCTGCTGCCCCAGAGTTGAgcccaagtggatccgattcccgaaagcccgcgctcgcgcgggctttttgcttgcttgccggc
cgatatcggctcgacatggcgcaatcgccggccatactgaagcaataagggcaatacggcatccgcatcgaatggcggggagtttctccgcggggggcgc
ATG

    CV1034 Gene: CV1034     GI: 34496489     BI number: CV1034     GOG: COG2202,COG2203,COG5001     Description: conserved hypothetical protei GC T  C C  C GC TA CG |  A        t CG       t  c GT       a  c AT        gc CG        cg |  A      |  a A  g      |  a Gc       c  a Gc       t  g A  c      a  c A  a       gc C  |       gc A  |       tg C  |       gc G  |      a  |       tc Ta       a  |      c  g Cg       c  |       gc Gt       c  |       cg Tg        cg        gc Cg        gc        cg A  a       At        cg At        Gc        cg Gc        Tg        gc                         tttttgcttgcttgccggccgatatcggctcgacatggcgcaatcgccggccatactgaagcaataagggcaatacggcatccgcatcgaatggcggggagtttctccgcggggggcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2202 FOG: PAS/PAC domain ... can be seen here [T] COG2203 FOG: GAF domain ... can be seen here [T] COG5001 Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain ... can be seen here     ..................................................................................................................