                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-19.40 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-17.10 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-17.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTTCTTCGTGGCCAGCGCGATCGAGATCACCTTCGACGACAGCCTGCCTTGCCCGC
TCAAGGCCCAGTCGACGATCACCGTGGTCTGAggccgcgccggctggacatcgcctgatcgcccatgccggcaaac
gtagggcggcccgccctggccgccctttttattcatgctttggccatgcgagccttccccatccacgccaaacgcatatacaattcatttacaaattaaa
gcgacatgctcagtcgagatggacgccagccgccccgtctctacccttcccccggaaaaccaagatATG

    CV1043 Gene: CV1043     GI: 34496498     BI number: CV1043     GOG: COG3416     Description: probable transmembrane protei            tg           a  c           c  c   g        cg c  c       cg gc        gc cg       |  a cg       |  a gc       |  a gt       c  c A  |      t  g G  |      a  t Tg       g  a Cg        tg Ta        cg Gc        cg G  a       gc        cc T  t       cg       g  c Gc        tg       c  t Cg       a  |       cg |  c      c  |       cg C  c      a  |       gc At        gc        gc Cg        gc        cg Ta       t  c       gc At        cg        gc Gc        gc        gc Cg        gc        at                         ttttattcatgctttggccatgcgagccttccccatccacgccaaacgcatatacaattcatttacaaattaaagcgacatgctcagtcgagatggacgccagccgccccgtctctacccttcccccggaaaaccaagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3416 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................