                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTCGCCCAGAAGGACGCCGGCGACGACGAGGCGATGCACTACGACGCCGACTACATC
CGCGCGATGGAATACGGCCTGCCGCCGACCGGCGGTTGCGGCATCGGCATCGACCGCT
TGGTGATGTTGTTGACGGATGCGCCTTCTATCCGGGATGTGATCTTGTTCCCGCATAT
GCGTCCGGAGTAAgctgtagcaagcttacattgggctaaagagaaagccgctcactgcaaggtgagcggcttttttgcgacctttaaacgt
agcctgtcctatttatccatcagaaatggaataacATG

    CV1059 Gene: CV1059     GI: 34496514     BI number: CV1059     GOG: NOG25064     Description: conserved hypothetical protei            ga           a  g           a  a           a  a            ta            cg            gc            gc           g  | ag       t  | t  c      t  | g  a      a  | ta       c  | cg       a  |       ca gc       t  |      g  a At       t  |       tg At        cg        cg Ta        gc        at Gc        at        cg A  a      a  c       ta Gt       c  a       cg Gt        gc        gc Cg        at        cg Cg        tg        cg Tg        gc        gc Gc        ta        at                         tttttgcgacctttaaacgtagcctgtcctatttatccatcagaaatggaataacATG     ..................................................................................................................