                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-20.00 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-16.74 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCGGCCGCTTCAAGCTGTAAgcgttttcgccgcgccggctggccggtgtggcgaaaaagccatggtttgggtgattttcgcc
aggaaaatcaaagccattggcataatcggttggcgcttcatcgcgtggcttgtaaacgttgtttacaatccacccggtctgaatacgcgccaatccttac
aagctgcgatccgcagcatgcgccggcgggagccggcggcacaaaaagggcgtcgtcgacgccctttttgccgtccagaggattggcaacgagagagaag
ctacaagtcgattgccATG

    CV1081 Gene: CV1081     GI: 34496536     BI number: CV1081     GOG: COG0840     Description: probable methyl-accepting chemotaxis protei   t a  c gc cg gc ta cg gc a  a a  t c  | a  | t  | t  | c  | c  | t  | a  |       gg a  |      g  a c  |       cg cg        gc gc        gc cg        cg gc        cg c  |       gc a  |      |  g t  |       cg a  |       gc a  |       ta gc       a  c        t tg       c  a      g  c cg       g  a       cg t  |      a  a       ta g  |      c  a       gc gc       g  a       cg cg        cg        gc cg        cg        gc cg        tg        gc                         tttttgccgtccagaggattggcaacgagagagaagctacaagtcgattgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................