                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-20.30 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-14.86 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGTCGACAAGATCGGCGACGTCGCGCTGTCCACCGGCGAGCAGCACAACGCCACCA
CGGCGATGGCGCAGAGCACCGAGTCCATCAATAACAAGATCCTGGATTCGGACGCCGC
GCTGCAGAGCGCCCAGCGCACGCTGAGCACGCTGGATGGCGTGGCGCGCAGCATGCAG
CAGGCGTTCAGCCGCTTCAAATTGTAAaccgcggccgtttttctgcgccgacgccagcccgcgggctggcgtttttattg
cctagacgggaaaatgtcgcaacgttatcaagcgaaaaggcgaacaATG

    CV1082 Gene: CV1082     GI: 34496537     BI number: CV1082     GOG: -------     Description: hypothetical protei   T T  G A  T A  A A  A C  a T  c T  c Cg        ga Gc       c  c Cg        cg Cg        gc Gc       c  | A  |       gc C  |       ta T  |       cg T  |      t  c Gc       t  |       gc Cg       t  |      c  g Gt       t  |       cg Gt       t  |       cg At       g  |       gc |  t      c  |       at C  t      c  |       cg Gc        gc        cg At        gc        gc Cg        cg        cg Gc        gc        at Tg        cg        gt                         tttattgcctagacgggaaaatgtcgcaacgttatcaagcgaaaaggcgaacaATG     ..................................................................................................................