                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-21.80 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-26.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGAAAAAGGGCGGCGCACACGGCCGCAGCCGATCCGGCCTGCGCCAATCGCAGAAAC
ATTCGCTGTGGGCGGAACTGGAAGACTGGCGCGAAGAGCGCGACCGGCAGCCGATGGC
CGCCGACCGCGGCCAGGACGCCGATGAGGCGTTTTTCTCCGCCGAGTTTCCAAAAGCA
ACAGGCCGTCAATCGATGGCCTGTTGCTTTTGGGCGTTCGTCCGCTAAcaattccgcacattcc
gtttacacaacgccacaaggcctgcccgtaaaatagcggacatctcaatcgggaatgtcgtcATG

    CV1083 Gene: CV1083     GI: 34496538     BI number: CV1083     GOG: NOG43546     Description: conserved hypothetical protei   G A  A A  G GC CG GC CG |  A GC GC TG CG         A A  C      G  C G  A      C  C A  G       CG A  |       GC GC        CG GC        CG TG        GC |  A       GC C  T       TA A  G      A  | A  G      G  | GC        CG         T GC        CG       A  G CG       G  A      G  A GC       A  C       CG GC        CG        CG G  G       GC        GC TA        GC        CG GC        CG        AT                         TTTTCTCCGCCGAGTTTCCAAAAGCAACAGGCCGTCAATCGATGGCCTGTTGCTTTTGGGCGTTCGTCCGCTAAcaattccgcacattccgtttacacaacgccacaaggcctgcccgtaaaatagcggacatctcaatcgggaatgtcgtcATG     ..................................................................................................................