                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=13 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGCGGCCGCACGATGGAGAGCGTGATCGAGCAATACCTGTCCACCGTGCGCCCGAT
GCACAACCAGTTCATCGAGCCGACCAAGCGCTTCGCCGACGTGATCCTGCCGCACGGC
GCCAACGATCCGGCGGTGGACATCATCACCACCAAGGTCGCCAGTCTGATGGTGTGAg
cgctcgccgcgcaggaaatcccaaagccgccccagaggcggctttttgcttgcccggttgacgccgtgctctcgcgggcggacaatcgccgcgcgccatc
cggcgcgtgatcacctaaggcacatcATG

    CV1084 Gene: CV1084     GI: 34496539     BI number: CV1084     GOG: -------     Description: hypothetical protei             a           a  t           a  c            gc            gc         a           a  a      c  g   g       c  a      c  a c  c      g  a       cg t  c       cg        cg cg        gc        gc gc       c  c       cg cg        cg        cg gc        gc        gc                         tttttgcttgcccggttgacgccgtgctctcgcgggcggacaatcgccgcgcgccatccggcgcgtgatcacctaaggcacatcATG     ..................................................................................................................