                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -7.77 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-25.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACTGGCGGACGCCCACCCGGACGTGGACCCGAAGACCGTGCGCTTCGTCGACCTGC
ACAACTGGGTGGTGGAGCTGCCCGGCTTCGACGACGACCACGCCCGCGGCGGCGAGCG
CGTGCTGGAGGCGATCCAGCAGGCGTGGATAGACGAAGCCGAGTGAtcttccgctcgcagcaaaaa
gccccggactccggggcttttttcatgtccctgcgcccgcgcgtgaaaatcccgccccgccggtttatcatcggaaagcacgcgccggccttcgccgccg
ccccgttacggagccgccATG

    CV1086 Gene: CV1086     GI: 34496541     BI number: CV1086     GOG: COG0625     Description: probable glutathione S-transferas   C G  G G  A AT GC GC TA CG GC        ct TA       t  t G  G      A  c CG        Gc GC        Tg CG        Gc GT        At |  G       Gc |  G      C  | |  A       Cg |  T       Gc |  A      A  a |  G      A  g        c |  A      G  c      a  t |  C      C  a       gc |  G      A  a       gc A  A      G  a       cg G  A      A  a       cg CG       T  a       cg GC       A  g       cg GC        Gc        gc CG        Gc        at                         tttttcatgtccctgcgcccgcgcgtgaaaatcccgccccgccggtttatcatcggaaagcacgcgccggccttcgccgccgccccgttacggagccgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0625 Glutathione S-transferase ... can be seen here     ..................................................................................................................