                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-22.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-14.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-17.63 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGGAAGACCGCCGCATCAAGATCAAGATCGAGGGCGAGCTGCCCAGCCCGCTGAATC
CGCCGTCCGGCTGCGCCTTCCACAAGCGCTGCCCGCACGCCAATGAGCGCTGCAAGGC
CGAGGTGCCGCAGCTGCGCGAACTGGATCAGCGCATGGTGGCCTGCCACCGCGCGGAA
GAGATCAACGGCTGAgaccaaatcggcactggaggcccgcggcgcgcgtcgtcgcgggcctttttcatttcaatgtcctgaagcccggg
cgtacactggctttcccacccctagcggagacttgccATG

    CV1102 Gene: CV1102     GI: 34496557     BI number: CV1102     GOG: COG2764     Description: conserved hypothetical protei CT C  G GC GC TA GC GC TG A  C        c CG       c  a GC       a  a |  G      g  a |  G       At |  A       Gc |  A       Tg |  G       Cg |  A       Gc |  G      G  a |  A      C  c |  T      A  t |  C      A  g        c |  A       Cg       g  g |  A       Ta       c  t |  C      A  g       gc |  G      G  g       cg CG       A  c       gt GC       G  |       gc AT       A  |       cg CG       A  |       gc TA        Gc        cg |  g       Gc        cg A  a       Cg        cg Gc        Gc        gc Gc        Cg        gc                         tttttcatttcaatgtcctgaagcccgggcgtacactggctttcccacccctagcggagacttgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2764 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................