                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-19.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCAGCGACTACGAGTACGAGCGCACGATGCGCTACATCAATTCCGACCTGCATCCG
GACATCACCACGCTGTTCCTGCTGCCGCCGCGCGAATACGCGGAGGTGTCGTCGACCA
TGGTCAAGGGCCTGATCGGCCCGCGCGGCTGGGAAGGCGTGATCCGCCAGTATCTGCC
GGAGCCGGTGTACCGCAAGATGCTGTCGATGTACTCCGAGCAATAGcgccttataatgccggtttg
aacaccgtgccgcgccagcccaggctggcgcgtttgttttgcagcaatcgaggatacgccATG

    CV1104 Gene: CV1104     GI: 34496559     BI number: CV1104     GOG: COG1092     Description: probable oxidoreductas   C T  C C  G A  A       ga TG       t  a GC       t  c TA        ta A  |       gc G  |       gc C  |       cg TA       |  t GT        cg TA        gc CG       t  c Gc       a  | Tg       a  | A  c      t  | Gc       a  | At       t  | |  t      t  | |  a      c  |       ca |  t       cg       c  g |  a       gc        cg |  a       cg        gc At        Gc        at Cg       A  c       cg |  c      T  a       cg Gc       A  |       gc Cg       A  |       cg Cg        Cg        gc At        Gc        cg                         tttgttttgcagcaatcgaggatacgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1092 Predicted SAM-dependent methyltransferases ... can be seen here     ..................................................................................................................