                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -3.51 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCGCTGCTGCTGCGCGACCCGCAGGGCGCGCTGCGCGGGCAGAGCGCGGCCGAACA
GCAGAGCATCCTGCGCCACACCACCCAGTTGAGCCATTATCGCCAGTTGGAGGACGTG
CGCGCCTATCCGGAACAGATCAAGAAACTGCTCACCCGCCTGAGCCGGGTGCGGATAG
ACCGGATGCTGAATCTGATGCTGTAAgcgccgtcccgccccttcaccccatagccccgcttgccggggctttttgccgccc
tcggctatgattaagcggagaaccggagtccctgtggagagggcgATG

    CV1110 Gene: CV1110     GI: 34496565     BI number: CV1110     GOG: COG0642,COG2203     Description: hypothetical protei   T C  G G  A        t TA       t  c AT       c  a GC       c  c GT       c  c CG       c  c |  A      g  c C  T      c  a A  G      c  t GC       c  a AT        tg TG        gc         t AT       c  c      t  g G  A      c  c      c  c G  A       gc        gc Cg        cg        cg Gc        gc        cg Tg        At        cg Gc        At        cg Gc        Tg        gc                         tttttgccgccctcggctatgattaagcggagaaccggagtccctgtggagagggcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here [T] COG2203 FOG: GAF domain ... can be seen here     ..................................................................................................................