                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-14.60 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-19.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCCTGGCCAGCAGCCGCTCGTTGCTGTAAGGACCGTACATGTCGGCGGTATCGAGGA
AGTTGACCCCCAGGTCCAACGCCGCGTCCAGCGTCGCCAGCGACTCGGCGTCGTCGCG
CGGGCCGTAGAAAGCGCTCATGCCCATGCAGCCGAGACCCAGCGCCGAAACCTGCGGG
CCGTTACGGCCCAGCGTGCGTTTTTGCATtgccttgctcccttggtgaaagtgcgttcagcataggcgctggcactacg
tagaaaaatggctgaaaatgacaaacattatttagccaggcttcacaATG

    CV1139 Gene: CV1139     GI: 34496594     BI number: CV1139     GOG: COG0583     Description: probable transcriptional regulator LysR famil   A G  A A  A TG GC CG |  C |  T |  C                  T |  A        C       T  A |  T      C  A       GC CG       C  G       CG GC       A  C       CG GC       G  G       GC GC       A  C       GC C  A       GC        GC GT        CG       |  A CG       |  A       CG GC       |  A       GC C  A      |  A      T  | T  |      C  C      C  | G  |       GC       C  | C  |       AT       A  | T  |       CG       A  | G  |       GC       A  | CG       T  |      G  | GC       A  |      C  | GC        CG        CG CG        CG        GT TA        CG        CG CG        GC        GC                         GTTTTTGCATtgccttgctcccttggtgaaagtgcgttcagcataggcgctggcactacgtagaaaaatggctgaaaatgacaaacattatttagccaggcttcacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................