                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=75 nt.     Delta G=-13.61 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCTTGATCATGCTTGTGGTCGTGCCCATGCCGGTCGCCCGGTTGGTGTTCGTGGCC
GCAGCCGCCCTGGCGTCCATGGGCATGCTCGCGCGTCTGCCGCTCTCCGCCGCCCTGG
GCCAGcgcggcccccgccttggatgagcagcaatcgccgccgcgggcagcttggtgtccctggtgcggcgatgcggccttgcgataacgcgtgatgc
ttgacatatgcgcctccattggtagtctgggcacattgcacaccctgtagtcactacagggtcaagcgtttttctcgggagaacgtcATG

    CV1153 Gene: CV1153     GI: 34496608     BI number: CV1153     GOG: COG0789     Description: probable transcriptional regulator, MerR famil            ca           c  t           t  t            cg            cg            gt           c  a           g  |           t  |           a  |           t  |           a  |            cg            at            gc           |  t            tg            tg aa        cg t  c       gc a  g       ta gc       a  | cg        gc gt        ta tg        gt ta       c  | c  t      g  | cg       c  | gc       a  |        c |  t      a  |      t  a gt       t  |       gc cg       a  |       at |  a       gt        ta gc        cg        gc ta        gc        ta at        ta        cg g  a      |  c       cg c  |      t  a       cg g  |      c  c       at gt       c  c      |  c cg        gc       c  a gc        gt       a  a tg        cg        cg gc        gt        gc gc        ta        tg                         tttttctcgggagaacgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0789 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................