                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGCCGCGGCCGCGGCCGGCCCGCCATTCCAGCCAACCCTGCTCGCGCATTCTGGCCA
GTTGCAGCCGCGCGTTGCGCTCGCTGCACCGCCACAGCTCGGCCAATTGGGACAGGCC
GGGCTGGGACGGCGCGTCGCCGTAAGCCAGATAGAGTTGCTCGTATTGCTGTTGCAGG
CGCATTTGGGCTTCCGGGTGAATGACGGCATAAAAGCGGAAGTATTTATTTGGACTTT
CATCCATttttacattccgctttatcggcaatactgcagcggttcccttcgctttacaaggtgttgtcGTG

    CV1179 --- estX Gene: CV1179     GI: 34496634     BI number: CV1179     GOG: COG0477     Description: probable multidrug resistance protein Gene: estX     GI: 34496635     BI number: CV1180     GOG: COG0596     Description: esterase/lipas GG A  C CG GC TA |  T |  T       CG T  T      A  G G  G       GC TG        TA CG        AT GC       A  A T  T      G  A T  T      T  A A  C      G  A T  |      G  G GC        GC CG        CG TG        CG CG        TA GT        TA TG        CG TA        GT             ATTTATTTGGACTTTCATCCATttttacattccgctttatcggcaatactgcagcggttcccttcgctttacaaggtgttgtcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [R] COG0596 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) ... can be seen here     ..................................................................................................................