                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgaacaggcgggtgagtttggagagcatgcggaagtccggatggggatatccgacgattttaatcggattctttcccgggcgcatcgcgccccgcgatct
tcgtatcttactcctgcgcgtcgtggccgggcagggaatttattgcgtatcagcgtttggtttataagttttttttgataaaagtctttgaaaagcgtag
aatttccggttcgccgccgcaaacgcgcggcgctcgttccaaggctcggccccgtcaggccgcgggccctgctctttgatcgaaaggctttctccgcttt
ATG

    CV1205 Gene: CV1205     GI: 34496660     BI number: CV1205     GOG: COG0477     Description: probable multidrug translocase protei   a t  c t  t c  c t  c        t at       g  g tg       c  g gc       t  c cg        gc t  c       cg t  |      g  g c  |       cg tg        gc at        ta gc        cg cg        cg gt        tg             aatttattgcgtatcagcgtttggtttataagttttttttgataaaagtctttgaaaagcgtagaatttccggttcgccgccgcaaacgcgcggcgctcgttccaaggctcggccccgtcaggccgcgggccctgctctttgatcgaaaggctttctccgctttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................