                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:108 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -9.20 kcal/mol
Antiterminator:    Distance from promoter:15 nt. Size=39 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-10.82 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGAAA-TAATAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAAAACTGATAAGGTGTTGAGTAATATTCAAACGGCATCGGATGGGTTTGCGCATC
ATGCAAATGATAAGACGATGGCTCAAGGAAAATAATTTTCCTTGACAGTGTTTTGTGG
TCATGAGTCACTTTCAACTCAAGATAAAGATCAATATTAATCGAATTTGTTTCGAATG
GAACCATcctaatattgatacgcctacttaattcaatcagaggcttgcaATG

    CV1219 --- CV1220 --- CV1221 Gene: CV1219     GI: 34496674     BI number: CV1219     GOG: COG0477     Description: probable permease transmembrane protein Gene: CV1220     GI: 34496675     BI number: CV1220     GOG: -------     Description: hypothetical protein Gene: CV1221     GI: 34496676     BI number: CV1221     GOG: -------     Description: hypothetical protei   A T  T A  T A  C       CA T  A      G  A G  A       TA A  A       AT GC        CG TG        TA TG        AT GC       |  A TA       |  A GT       |  G        A GC       C  A      T  A A  G       GC        AT A  G       CG        AT TA       G  A       AT AT       T  T       AT G  G       TG        GC TG        TG        GC CG        GC        AT AT        GT        AT AT        GC        CG AT        TA        TA                         CAGTGTTTTGTGGTCATGAGTCACTTTCAACTCAAGATAAAGATCAATATTAATCGAATTTGTTTCGAATGGAACCATcctaatattgatacgcctacttaattcaatcagaggcttgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................