                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggatctgggcctatcacgatgtggattagctgatgacctgcatccatgctggccgagagcgtgacggtgttttgctgactgaaatggggacttatacaa
gtgctgtgatggtgtttccatagactattttcagagccgctattgggggcgcattgtttttaacctgtactttggtgtaggttattcagctttccggcta
ggttgccttgtaggtggtctggtattttcataacattcttaatcttctttttagttcaatgacataccctcgctggagggtatttatatttggattcctg
ATG

    CV1233 --- CV1234 --- CV1235 Gene: CV1233     GI: 34496688     BI number: CV1233     GOG: COG3501     Description: probable vgr-related protein Gene: CV1234     GI: 34496689     BI number: CV1234     GOG: COG1502     Description: probable phospholipase protein Gene: CV1235     GI: 34496690     BI number: CV1235     GOG: COG0790     Description: probable lipoprotei tt t  g cg at        tc tg       t  c gt        tg         g ta        cg       t  t cg        gc       t  a cg        at        cg at       c  a       cg at       t  g       gt ta        tg       t  g |  t       at       t  g t  t      t  t       gt t  c       tg        gc ta        gc        at tg        gc        tg gc        at        cg                         tattttcataacattcttaatcttctttttagttcaatgacataccctcgctggagggtatttatatttggattcctgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3501 Uncharacterized protein conserved in bacteria ... can be seen here [I] COG1502 Phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthases and related enzymes ... can be seen here [R] COG0790 FOG: TPR repeat, SEL1 subfamily ... can be seen here     ..................................................................................................................