Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-25.40 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGGATCGCCTACGCGGCAAGCCTGATCAATTGGAGGCTGCGGTAACGTGGACACTG
CAAAGCTACGAGAAAGAAGCGCAGGGCTGAtcgtcatcgcgccgatcacagcccgtgaagaatgaatagccaagcagg
gtcagccagactggatgtcccgcttccagaggatgcatgatcatcaccgttgcgtgttcttctgacatgccagcctgcctgcggggtaggctggcatttt
atttcccgtatgaaacaagagaagctaccatccccgtctaatgactggcccataacagtcaacgATG

    CV1236


Gene: CV1236     GI: 34496691     BI number: CV1236     GOG: -------     Description: hypothetical protei


            t
          t  c
          c  t
           tg
           ta
           gc
           ta
           gt
           cg
          |  c
           gc
           ta
 at        tg
c  c       gc         c
t  a      c  c      g  g
a  c      c  |      t  g
 gc       a  |       cg
 tg       c  |       cg
|  t      t  |       gt
 at        at        ta
 cg        cg        cg
 gc       t  c       cg
 tg       a  c       gc
 at       g  |       at
g  g      t  |       cg
 gt        at        cg
 at        cg        gc
 gc        gc        ta
 at        tg        at
                        tttatttcccgtatgaaacaagagaagctaccatccccgtctaatgactggcccataacagtcaacgATG


    ..................................................................................................................