                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:10 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-10.20 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-23.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcgtgagtatgacttgcggatgctctggggtttcaagccaacagcttcggcgaactcgtcggtagaaagggtaggacggactgtgtatttgcttttagtt
gggtaagtcatgattatccccttgttgatggtatatgctgcatccagctcgtgaagggcatggaggctgggagagcttgagctcggtgcgacacctgggt
ttcgcacatgcaccgggagctgtgatgctctgtagtgcatggcgacgaatgatggtggtgcgaggggatttgagcagccccagcatttatttcaaaacag
GTG

    CV1247 Gene: CV1247     GI: 34496702     BI number: CV1247     GOG: -------     Description: hypothetical protei             a           a  t           g  g tg       c  a g  a      a  t t  t      g  g cg        cg gc        gt at       g  g gc        tg gt        at |  g       cg        ga g  t       gc       t  g c  a       tg       t  c cg       g  |      t  a at       a  |      a  g cg       t  |       gc gc       g  |       gc ta        ta        gc at        cg        gc cg        tg       a  a a  |       cg       g  | cg       g  g       cg gc        ta        gc cg        at        ta ta        gt        gt                         ttatttcaaaacagGTG     ..................................................................................................................