                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-16.30 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-19.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCGGCCGGCAGGCTGGCCAGCGCGGCGGCGAGGAAAGTCAGCGAAGGGAGGAGGCG
GCTCATggaaggctccgggagttggaatcgcgccagcttacgccttgtgccgcgggtttcggatcgcctgatccatcctgcttgatggctgtcaaa
caggaggtttttcctgcttttttgtggttgtttttgctatgaaaattttaatcagtaaaaattccattcgcatgttgatgatggattgccctggcggtaa
catgatttttccgcgcgcatgccgcgcttggcgccgggccgcagcgATG

    CV1270 Gene: CV1270     GI: 34496725     BI number: CV1270     GOG: COG1506     Description: probable dipeptidyl anminopeptidas ta t  c cg gc |  c a  t c  t cg        cc gt       g  t cg        cg gc        ta c  c       at t  g       gc a  |       gc a  |      c  a g  |      t  t gc       t  | tg       t  | tg        gc g  g       gc at        gt        gc gt        cg       g  t gt        gc        tg gc       c  t       at cg       c  t       gc cg       g  g       ta ta       t  a       ta |  t      g  t      c  a |  c      t  |       gc cg       t  |       ta gc        cg        cg gc        cg        cg at        gc        ta                         ggtttttcctgcttttttgtggttgtttttgctatgaaaattttaatcagtaaaaattccattcgcatgttgatgatggattgccctggcggtaacatgatttttccgcgcgcatgccgcgcttggcgccgggccgcagcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1506 Dipeptidyl aminopeptidases/acylaminoacyl-peptidases ... can be seen here     ..................................................................................................................