                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-16.80 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-18.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGGCTACGGCCTGGCCCGCTTCGTCAGCGAGTACTTCCGCAATCCGGACGCCGGCA
TCTTCGGCAAGTCCGACGTGATCAGCATGGGGCAGTGGCTGAGCCTGCCGATGATCGT
GATCGGCGTCGCGCTGCTGGTCTTCTTCGGCCGGCGCAAACAGGGCTGAgcggtttgaacgcga
aaggccggggcatcccggccttttttgcgcccgaaaaatgcaacacaccagctttaaaacaaattccggaatatataactaattttttataatttctgga
tattaattgattcgggtaagATG

    CV1275 Gene: CV1275     GI: 34496730     BI number: CV1275     GOG: COG0834     Description: probable ABC transporter, periplasmic-binding protei CT T  T T  C CG        Ag TG       G  c GC        Tg GC        Cg TG        Gt CG        Gt GC        Gt T  |      A  g CG       C  a GC       A  a |  A      A  c |  A      A  | |  A       Cg C  C       Gc        ca G  A       Cg       g  t CG       |  a       gc TG       G  a       gc G  |      G  a       gc CG        Cg        cg GC        Cg        cg GT        Gc        gc CG        Gc        gc TA        Cg        at                         tttttgcgcccgaaaaatgcaacacaccagctttaaaacaaattccggaatatataactaattttttataatttctggatattaattgattcgggtaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................