                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGCTGGCAAGGCTGATCGCCGAGGCCAGCCGCCACAGCCAGCTGTGGGTAACCAGC
CACTCGCCGGAATTGGCGGAACGGATCCGCCGCCACCGGCCGCTGAAAACCTTCCAGC
TCTCCCTACGGGACGGCGAAACCGTGCTGCAGGACGACTGAcgcgtccgagcccccaagccgccgccagg
cggcttttttgcgtgcgctcccgggacaaaattcgccgaattcccgccatatgacgatgccgcatcaggatatgcggggaactccgccagcggggagtca
gtcctatcctcgtcTTG

    CV1279 --- CV1278 Gene: CV1279     GI: 34496734     BI number: CV1279     GOG: COG2076     Description: probable multidrug transmembrane resistance signal peptide protein Gene: CV1278     GI: 34496733     BI number: CV1278     GOG: COG2076     Description: probable multidrug transmembrane resistance signal peptide protei             G   A       T  A G  A      C  c C  A      A  g GC        Gc GC        Cg CG        At AT        Gc G  G       Gc GC       |  g GT       A  a CG        Cg A  C       Gc TA       |  c CG       |  c CG       |  c       cc C  A      |  c      g  a T  C      |  a       cg CG        Ta        cg TA        Cg        gc C  |       Gc        cg GC       T  |       cg AT        Gc        gc CG        Cg        at                         tttttgcgtgcgctcccgggacaaaattcgccgaattcccgccatatgacgatgccgcatcaggatatgcggggaactccgccagcggggagtcagtcctatcctcgtcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2076 Membrane transporters of cations and cationic drugs ... can be seen here [P] COG2076 Membrane transporters of cations and cationic drugs ... can be seen here     ..................................................................................................................