                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-15.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCAAGCCGACGCTGGAAATCAATCCGGAGCATGTGCTGGTCAAGCGTTTGGCCGAG
GAGTCCGACGAGGCCCGCGCCGGCGACCTGGCCGCCGTGCTCTACGATCAGGCCTTGC
TGGCCGAAGGCGGCAAGCTGGAAGACCCTGCCTCCTTCGTCAAGCGCATCAACAAGCT
GATGCTGGAGTTGTCGGTCTGAgcctgcaggcgcagattccgcaaatgaaccgccctttccctgggcggttttttattgccgtt
gtcctaaaatgaaagtccctgcaagcgaaccaggagacggcgATG

    CV1319 Gene: CV1319     GI: 34496774     BI number: CV1319     GOG: COG2764     Description: conserved hypothetical protei gc t  a cg cg gc A  g Gc Ta Cg Ta |  t |  t Gc Gc Cg         c T  |      t  c Gc       t  c Ta       t  t Ta        cg |  a       cg |  t       cg |  g       gc G  a       cg A  a       cg Gc        at Gc        at Tg        gt             tttattgccgttgtcctaaaatgaaagtccctgcaagcgaaccaggagacggcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2764 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................