                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-24.50 kcal/mol
Antiterminator: Size=71 nt.     Delta G=-19.40 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-22.32 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCACCTCGTCGCGGTTGGACCTGTTTTCCAAGATCCGCCACCGCGACTTTCCCGGCG
GCAAGCTGCTGCGCACCCCGGCGCTGGTGTTGGGGATGGCTTACTACCGGATCAGGGA
TTATCTGTAGacagcgccggcgtaggcgttatgtctgaagcccgagcatgtgatagcgtgctcgggctatttattttattggtcgtttaccgg
gaaataattgcgggcttatttgctgtatcatgttgattttatagatctaaggcttttctccgcttgtgtggtcctgctttctcggtaaacgTTG

    CV1335 --- CV1336 Gene: CV1335     GI: 34496790     BI number: CV1335     GOG: -------     Description: hypothetical protein Gene: CV1336     GI: 34496791     BI number: CV1336     GOG: -------     Description: hypothetical protei            cg           g  t           g  a            cg            cg            gc            cg            gt           |  t           |  a            at AT        cg G  C       at G  A       Gc CG        At CG        Tg A  G      G  a T  A       Ta C  T       Cg A  T      T  | T  A      A  | T  T      T  | C  |      T  | GC       A  | GT        Gc TG        Gc AT        Gc        at G  A      A  |      g  a G  G       Cg        tg G  a       Ta        gc Gc       A  g       tg Ta       G  c       at Tg       G  a       cg Gc       C  t       gc Tg       C  |       at Gc       A  |       gc Gc       T  |       cg Tg        Cg        cg Cg        At        cg Gc        Tg        gc Cg        Ta        at                         atttattttattggtcgtttaccgggaaataattgcgggcttatttgctgtatcatgttgattttatagatctaaggcttttctccgcttgtgtggtcctgctttctcggtaaacgTTG     ..................................................................................................................