                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-25.00 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-24.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGGCGACAACGCGATGCTGAACACCACGCTGTGGGGCGAGTTCATGAAGCTGCAGGG
GCCGGCGATCCAGAACATGATGGCCAACTACATGGAGCAGAGCACCGGCATGTTCCTG
GAAATGCAGAACCGCATGCAGGAGCAAACCAAGCAGCTGTTCGGCGGTTTCGGTTTTC
CCGGCTATCCGGGGGCGGAAGACAAGGACAAATCCTGAgcggcgcgcgttcgggatgcgatagggccgggga
tgccattccccggccttgttttttcccgcgggcagaatgggtagggaggcgcgcATG

    CV1368 Gene: CV1368     GI: 34496823     BI number: CV1368     GOG: COG4976     Description: conserved hypothetical protei   g c  c g  g gc cg gt At Gc Tg Cg Cg Ta At A  g A  c C  g A  a G  t G  a A  g A  g C  | A  | G  | A  | A  | G  |       cc G  |      g  a Cg       t  t Gc        at Gc        gc G  g       gc G  g       gc G  |       gc Cg        cg Cg        cg Ta        gc At        gc T  |       gt Cg        at Gc        tg Gc        at             tttttcccgcgggcagaatgggtagggaggcgcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4976 Predicted methyltransferase (contains TPR repeat) ... can be seen here     ..................................................................................................................