                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-15.90 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTACACGCTGGTGTTGACCTGCTTGAACGACTATTCCGGCACCGCGGTGTTTACCCAA
ACGCAGGGCGCCGTTCCACCGGACAACCGCCAGAACACGGTGCGCTACACGATAGAAC
AATAAcggacccgagcgcggcatgggcgatgccagccgccggccggcggctggatgcgggcagacgggataattcgccgatgccgcgggcgacgcct
gatcgatgcgcgccgaagacagatgcgtatcgcgaggcaaaccgttgtataatcgcgcgattttgttttcgccccaagatgttgaacATG

    CV1373 Gene: CV1373     GI: 34496828     BI number: CV1373     GOG: COG0621     Description: probable oxidoreductas             g           a  a           a  c           g  a           c  g           c  a            gt            cg        cc            gc       a  g   t        cg        at a  c       gt        at g  g       ta        cg t  a       at        gt c  t       gc       |  a cg        cg       |  t gc       t  c      |  a cg       a  g      g  a a  |      g  |       at gc        ta        gc cg        cg        cg gc        cg        gc gc        gc        cg                         cgattttgttttcgccccaagatgttgaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0621 2-methylthioadenine synthetase ... can be seen here     ..................................................................................................................