                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-26.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGACGAGATCGACGACGAAGGCACCGCCGTTTGCCGCAGCTATGCCGACGCGCCGG
AGATCGACGGCCTGGTGTTCGTCGAGGACGCCGCCGGCATGCAGCCGGGCGAGTTCTA
CCAGGTGGAAATCGTCGACTGCAGCGAGCACGACCTGTGGGGCGAGCGCCGCTGAggcg
cggctcgctggcaggccaaggcgccgggtttcgacccggcgcttttttttatttcggatgcggtagattttttgacattccagcccttgtcgcggaaggg
ttgacggtataatggccgacagcttATG

    CV1374 Gene: CV1374     GI: 34496829     BI number: CV1374     GOG: COG0517,COG5001     Description: conserved hypothetical protei AG G  C CG GC GC |  G GC GT TG G  | TA Cg Cg A  | Gc Cg |  c                 tc A  g                t  g Cg        aa        ta Gc       c  g       gc At        cg        gc Gc        gc        gc Cg       g  |       cg Gc       a  |       cg At        cg        gc |  g       gc        cg Cg        gc        gc Gc        tg        gt Ta        cg        at                         ttttttatttcggatgcggtagattttttgacattccagcccttgtcgcggaagggttgacggtataatggccgacagcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0517 FOG: CBS domain ... can be seen here [T] COG5001 Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_violaceum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-15.20 kcal/mol Antiterminator: Size=20 nt.     Delta G= -8.10 kcal/mol Anti-antiterminator:   Size=50 nt.     Delta G=-17.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTGGACGAGATCGACGACGAAGGCACCGCCGTTTGCCGCAGCTATGCCGACGCGCCGG AGATCGACGGCCTGGTGTTCGTCGAGGACGCCGCCGGCATGCAGCCGGGCGAGTTCTA CCAGGTGGAAATCGTCGACTGCAGCGAGCACGACCTGTGGGGCGAGCGCCGCTGAggcg cggctcgctggcaggccaaggcgccgggtttcgacccggcgcttttttttatttcggatgcggtagattttttgacattccagcccttgtcgcggaaggg ttgacggtataatggccgacagcttATG     CV1374 Gene: CV1374     GI: 34496829     BI number: CV1374     GOG: COG0517,COG5001     Description: conserved hypothetical protei GC A  A GC CG |  A |  C GC AT CG GT TG CG A  | G  | CG TG GC        TG CG       C  A       tc TA        Gg       t  g A  G       Cg        ta A  C      C  |       gc A  G      G  |       gc GC        Cc        gc GC        Gg        cg TG        Ac        cg GC        Gg        gc GT        Cg        cg                         cttttttttatttcggatgcggtagattttttgacattccagcccttgtcgcggaagggttgacggtataatggccgacagcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0517 FOG: CBS domain ... can be seen here [T] COG5001 Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain ... can be seen here     ..................................................................................................................