                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAagacaaaaacccgatctaaaattctaccgattttcccagtcatgaagcggcgttcaaatcagcacggcaaaccccgccaggccttggcaaatc
gtcccatgcacaagggtccgacactgctcgcccctgatgctgaacgccaagcttcctcaacagcaaggcttaggctaggtcagcagccatagcgtacctt
cattccatcgacatgcaagcaaaaagcgcctggccggcgcttttttcatgcctgtccccaactggtatactgtttctccgccccatcccgccgaaatcgc
gccATG

    CV1376 --- serS Gene: CV1376     GI: 34496831     BI number: CV1376     GOG: COG2256     Description: probable ATPase associated with chromosome architecture Gene: serS     GI: 34496830     BI number: CV1375     GOG: COG0172     Description: seryl-tRNA synthetas            at           c  c            cg            ta           |  c            ta            at            cg   g       |  c a  c       ta c  a       ta tg        cg gc       |  c gc       |  a |  a      |  a at       |  a ta       c  a cg       a  a gc        tg g  g       gc         g at        cg       g  c ta        gc       t  c t  |      a  c       cg c  |      t  |       cg gc        at        gc gc        cg        cg at        cg        gc at        gc        at                         tttttcatgcctgtccccaactggtatactgtttctccgccccatcccgccgaaatcgcgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2256 ATPase related to the helicase subunit of the Holliday junction resolvase ... can be seen here [J] COG0172 Seryl-tRNA synthetase ... can be seen here     ..................................................................................................................