                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCGGACGCCCCGCTGCCGAAATCGATGCCCTGGCCTCTGGACTGAtccgcccaggccgccgcg
cggcggccccctctccactccgcggttccaggtttccggctctttccgaccagcccgtcagcgggcaatccaatgcctttgctcaaaatcaaaagcgagc
aaccattttctattgagtttttactccagctgggtatatttagcaattgctgacaaatgttggcgtttttataaaccatttaatatgctcagccattcgc
gacaccagaatgctgcgcagcccgggagtccgctcATG

    CV1440 Gene: CV1440     GI: 34496895     BI number: CV1440     GOG: NOG05988     Description: probable hydrolase transmembrane protei gc a  t cg cg t  | cg at ta t  t                 aa t  |                a  t t  |       at        cg ta       a  t       at gt        cg       g  t at        gc       t  g gt        at        cg ta        tg        gc tg        ta        tg                         tttttataaaccatttaatatgctcagccattcgcgacaccagaatgctgcgcagcccgggagtccgctcATG     ..................................................................................................................