                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-18.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggtatggcggcgcgcggcctgcaataagaacaggctgcggtccgcgagcagcggcctggcggccgcagtggaaaatgagtggattggccggcttcgccgg
tggttttgctgcaagatcatcgtcctttcgtgataaagatttggcaaaatcgtgttcaatattttcaacgcttcgtccatcctagccagcgtccgcggcc
attcgcaacggacgacggccattggctgtcatttttagtcaacaataggacaaacaacgcaacaggacggcagcgtcaaagtgcattagaattaagcgat
ATG

    CV1447 Gene: CV1447     GI: 34496902     BI number: CV1447     GOG: NOG11255     Description: conserved hypothetical protei   t a  t c  c cg gc g  a c  a gc cg cg         t ta       a  t gc        cg cg        cg g  a       gc a  c       gt cg        cg cg        at gc        gc             atttttagtcaacaataggacaaacaacgcaacaggacggcagcgtcaaagtgcattagaattaagcgatATG     ..................................................................................................................