                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGACGGCCGCTTCATCAAGCGCATCGCGCGCGAGCTGGTGGAATTCGGCCCCATCA
ACGCCACCATCCACAAGCTGAACGAATGCGTGGAAGTGGCCGACGTGGAGCCGCTGGC
CGCCATCTACCGCCGCACGCTGGAGGGGCTGCTGGCCAAGGCATGAgggcctgcgctccgctatgc
tgaaaccggcgcccgcgccggttttttcacatccacgccgcgtccctggcgcaaccatggtttttcgcgtctccacgccgaatgttgcggatcgaactaa
caggtaagctccatcatcATG

    CV1455 Gene: CV1455     GI: 34496910     BI number: CV1455     GOG: COG2095     Description: probable multiple antibiotic resistance protein Mar tg c  c cg gc |  t gc gc |  g A  c Gt Ta At Cg Gc Gt        cc A  g      c  g A  a       gc C  a       cg C  a       gc Gc        gc Gc        cg Tg        cg Cg        at             tttttcacatccacgccgcgtccctggcgcaaccatggtttttcgcgtctccacgccgaatgttgcggatcgaactaacaggtaagctccatcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG2095 Multiple antibiotic transporter ... can be seen here     ..................................................................................................................