                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-20.52 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-25.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgggtttctccgtcgtgcgggttttagcgagcttcgtcgcggcgggagcggcggcgaacggttttgcgagtcgctatttaatagttgttgttgtcggccg
tcaggccattgcgatcaaaccgcggtttgatccgcggtaatgtaccgtaactgaaatcgtctcgcaaaagttgtctggcataggccggcttccggtgccg
ggaggtccggccgggccggttttcttttttgcggaaataggttacaatcgcagcggttagggatgggcgtttcgcccattttttatttgtggaaaaagca
ATG

    CV1460 --- nusA --- infB Gene: CV1460     GI: 34496915     BI number: CV1460     GOG: COG0779     Description: conserved hypothetical protein Gene: nusA     GI: 34496916     BI number: CV1461     GOG: COG0195     Description: N utilization substance transcription regulator protein Gene: infB     GI: 34496917     BI number: CV1462     GOG: COG0532     Description: translation initiation factor IF-             g           g  t           a  t           t  a           a  c           a  a           a  a            gt            gc            cg            gc            ta            tg           t  |           t  |           t  |           t  |           c  |           t  |           t  |           t  | gg       t  | g  a      g  | cg        gc cg        cg gt        cg t  |       gt gc       g  t gc       g  a cg        cg cg        cg |  c      |  g        t |  c      g  a      t  t tg        gt        gc tg        cg        cg cg        cg        gc gc        tg        gc gc        gc        gc cg       g  g       ta cg        at        at gt        gt        gt gt        gt        gt at        gc        gt                         ttatttgtggaaaaagcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG0195 Transcription elongation factor ... can be seen here [J] COG0532 Translation initiation factor 2 (IF-2; GTPase) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_violaceum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:70 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-19.00 kcal/mol Antiterminator: Size=44 nt.     Delta G=-13.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cgggtttctccgtcgtgcgggttttagcgagcttcgtcgcggcgggagcggcggcgaacggttttgcgagtcgctatttaatagttgttgttgtcggccg tcaggccattgcgatcaaaccgcggtttgatccgcggtaatgtaccgtaactgaaatcgtctcgcaaaagttgtctggcataggccggcttccggtgccg ggaggtccggccgggccggttttcttttttgcggaaataggttacaatcgcagcggttagggatgggcgtttcgcccattttttatttgtggaaaaagca ATG     CV1460 --- nusA --- infB Gene: CV1460     GI: 34496915     BI number: CV1460     GOG: COG0779     Description: conserved hypothetical protein Gene: nusA     GI: 34496916     BI number: CV1461     GOG: COG0195     Description: N utilization substance transcription regulator protein Gene: infB     GI: 34496917     BI number: CV1462     GOG: COG0532     Description: translation initiation factor IF- ta a  g cg gc gc t  |       gg cg       g  a tg        cg gc        cg t  t       gt t  t      t  | g  c       gc a  c       gc a  g       cg a  g       cg at       |  c cg       |  c |  c       tg gc        tg cg        cg tg        gc cg        gc ta        cg             gttttcttttttgcggaaataggttacaatcgcagcggttagggatgggcgtttcgcccattttttatttgtggaaaaagcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG0195 Transcription elongation factor ... can be seen here [J] COG0532 Translation initiation factor 2 (IF-2; GTPase) ... can be seen here     ..................................................................................................................