Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-22.00 kcal/mol
Antiterminator: Size=58 nt.     Delta G=-21.90 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-11.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGATGACCGCGGCCGCATCCGCCTGTCCATCAAGGCGCTGCTGGAAGAAGAAGCGA
AAACCGCCCAAGCGACCGCTGACGCCTTCGGCCTGAAGACCCAGTAAgtccggttgatagccgtt
cctgcctggagcggacgccagccagaaccccctgccatggcagggggttttgttttaaatcgcgaggctgtttaattgactgatagcctggccgcttgcc
gttgatgcgagtccgctcgcgatcggtttccggctgcgcggcctggagcgaaaatagaaagtccgtaaatttgcccgATG

    CV1467


Gene: CV1467     GI: 34496922     BI number: CV1467     GOG: -------     Description: hypothetical protei


            c
          g  c
          t  t
           cg
           cg
           ta
  C        tg
C  A       gc
 CG        cg
 AT        cg
|  A      g  a
G  A      a  c
A  g      t  g
 At       a  c
 Gc        gc
T  c       ta
 Cg        tg
 Cg        gc        at
 Gt        gc       c  g
 Gt       c  a       cg
 Cg        cg        gc
 Ta        ta        ta
|  t      |  a       cg
 Ta       g  c       cg
 Cg       A  c       cg
C  c      A  c       cg
 Gc       T  c       cg
 Cg        Gc        at
 At        At        at
 Gt        Cg        gt
                        tgttttaaatcgcgaggctgtttaattgactgatagcctggccgcttgccgttgatgcgagtccgctcgcgatcggtttccggctgcgcggcctggagcgaaaatagaaagtccgtaaatttgcccgATG


    ..................................................................................................................